Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5852

expand all nodes | collapse all nodes | view schema

Name Class

Expr5852Expression_of (2)
HomolHomol_homolF25B5:Expr
Expression_data (2)
TypeReporter_gene[F25B5.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCGAGTGCGTTCTGGAAA] 3' and primer B 5' [TCCTTGCACCACTGATCTTTTA] 3'.
PatternAdult Expression: Reproductive System; vulval muscle; spermatheca; body wall muscle;
RemarkStrain: BC11029
ReferenceWBPaper00006525
TransgeneWBTransgene00002454