Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5857

expand all nodes | collapse all nodes | view schema

Name Class

Expr5857Expression_ofGeneWBGene00000396
Reflects_endogenous_expression_ofWBGene00000396
HomolHomol_homolF25F2:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[cdh-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTTCTGAATCTACTTTGAGG] 3' and primer B 5' [ACCCGATGTTTCTTGATTATTTTT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; excretory cell; Nervous System; head neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; excretory cell; Nervous System; head neurons;
Picture (7)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16095
ReferenceWBPaper00006525
TransgeneWBTransgene00004169