WormBase Tree Display for Expr_pattern: Expr5863
expand all nodes | collapse all nodes | view schema
Expr5863 | Expression_of | Gene | WBGene00009119 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00009119 | ||
Homol | Homol_homol | F25H2:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0003681 | |||
WBbt:0004292 | |||
WBbt:0005300 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005812 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [F25H2.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTCGTTTCTGCGAATTTTATTT] 3' and primer B 5' [TCAGTGTTGCTGATTTTCGG] 3'. | |
Pattern | Adult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; | |||
Picture | WBPicture0000004906 | ||
Remark | Also expressed in (comments from author) : mosaic population.L1s are mainly intestinal and hypodermal expression. Later stages express GFP in other tissues. | ||
Strain: BC12969 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004509 |