Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5869

expand all nodes | collapse all nodes | view schema

Name Class

Expr5869Expression_ofGeneWBGene00017805Inferred_automatically
Reflects_endogenous_expression_ofWBGene00017805
HomolHomol_homolF26A1:Expr
Expression_data (2)
TypeReporter_gene[F26A1.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAGCGATCAAAAAGTCTCTTA] 3' and primer B 5' [TGCTGACGTCATTCCTGAAA] 3'.
PatternAdult Expression: intestine; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body;
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC12389
ReferenceWBPaper00006525
TransgeneWBTransgene00002912
Historical_geneWBGene00017804Note: This object originally referred to WBGene00017804. WBGene00017804 is now considered dead and has been merged into WBGene00017805. WBGene00017805 has replaced WBGene00017804 accordingly.