WormBase Tree Display for Expr_pattern: Expr5869
expand all nodes | collapse all nodes | view schema
Expr5869 | Expression_of | Gene | WBGene00017805 | Inferred_automatically |
---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00017805 | |||
Homol | Homol_homol | F26A1:Expr | ||
Expression_data | Life_stage (2) | |||
Anatomy_term | WBbt:0003679 | |||
WBbt:0005300 | ||||
WBbt:0005735 | ||||
WBbt:0005772 | ||||
WBbt:0006749 | ||||
WBbt:0006750 | ||||
WBbt:0006751 | ||||
Type | Reporter_gene | [F26A1.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGAAGCGATCAAAAAGTCTCTTA] 3' and primer B 5' [TGCTGACGTCATTCCTGAAA] 3'. | ||
Pattern | Adult Expression: intestine; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; | |||
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; | ||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | |||
Strain: BC12389 | ||||
Reference | WBPaper00006525 | |||
Transgene | WBTransgene00002912 | |||
Historical_gene | WBGene00017804 | Note: This object originally referred to WBGene00017804. WBGene00017804 is now considered dead and has been merged into WBGene00017805. WBGene00017805 has replaced WBGene00017804 accordingly. |