Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5911

expand all nodes | collapse all nodes | view schema

Name Class

Expr5911Expression_of (2)
HomolHomol_homolF28F9:Expr
Expression_data (2)
TypeReporter_gene[zag-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGATATTGGACACCACCGTC] 3' and primer B 5' [GCGATATCTACGATTTTACCTGGA] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons;
PictureWBPicture0000004996
RemarkStrain: BC13074
ReferenceWBPaper00006525
TransgeneWBTransgene00004510