Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5918

expand all nodes | collapse all nodes | view schema

Name Class

Expr5918Expression_of (2)
HomolHomol_homolF30A10:Expr
Expression_dataLife_stage (2)
Anatomy_term (16)
TypeReporter_gene[stn-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCCTTGTCTCTCGCTCAATACA] 3' and primer B 5' [GCCGATCTAATCGGAGCA] 3'.
PatternAdult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons;
Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons;
PictureWBPicture0000005013
WBPicture0000005014
WBPicture0000005015
WBPicture0000005016
RemarkAlso expressed in (comments from author) : Note: primers are not unique and produce 2 products. Can predict correct product.Mosaic population.
Strain: BC14057
ReferenceWBPaper00006525
TransgeneWBTransgene00003386