WormBase Tree Display for Expr_pattern: Expr5921
expand all nodes | collapse all nodes | view schema
Expr5921 | Expression_of | Gene | WBGene00004036 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004036 | ||||
Homol | Homol_homol | F31B12:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005772 | Partial | |||
Remark | ant and post cells | ||||
Type | Reporter_gene | [plc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGCCTTGTTCAATTGTCCG] 3' and primer B 5' [GAGTGTCCCAGTTGATTGCAT] 3'. | |||
Pattern | Adult Expression: intestine - ant and post cells; | ||||
Larval Expression: intestine - ant and post cells; | |||||
Remark | Strain: BC13488 | ||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003188 |