WormBase Tree Display for Expr_pattern: Expr5944
expand all nodes | collapse all nodes | view schema
| Expr5944 | Expression_of | Gene | WBGene00009367 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00009367 | ||
| Homol | Homol_homol | F33H2:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0003679 | ||
| WBbt:0003681 | |||
| WBbt:0003822 | |||
| WBbt:0003833 | |||
| WBbt:0004292 | |||
| WBbt:0004506 | |||
| WBbt:0004520 | |||
| WBbt:0005175 | |||
| WBbt:0005300 | |||
| WBbt:0005319 | |||
| WBbt:0005342 | |||
| WBbt:0005733 | |||
| WBbt:0005735 | |||
| WBbt:0005747 | |||
| WBbt:0005751 | |||
| WBbt:0005767 | |||
| WBbt:0005776 | |||
| WBbt:0005798 | |||
| WBbt:0005800 | |||
| WBbt:0005813 | |||
| WBbt:0005821 | |||
| WBbt:0005828 | |||
| WBbt:0006748 | |||
| WBbt:0006749 | |||
| WBbt:0006750 | |||
| WBbt:0006751 | |||
| WBbt:0006760 | |||
| WBbt:0006769 | |||
| WBbt:0006789 | |||
| Type | Reporter_gene | [F33H2.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACATAATCGATAGACTCCCAGC] 3' and primer B 5' [TAGACGGGATGATTGAGGATG] 3'. | |
| Pattern | Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; | ||
| Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; anal sphincter; rectal epithelium; Reproductive System; distal tip cell; developing gonad; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; excretory gland cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; | |||
| Picture | WBPicture0000005052 | ||
| WBPicture0000005053 | |||
| WBPicture0000005054 | |||
| WBPicture0000005055 | |||
| WBPicture0000005056 | |||
| WBPicture0000005057 | |||
| WBPicture0000005058 | |||
| Remark | Also expressed in (comments from author) : Mosaic population.Hypodermis: only in the tail.Coelomocytes: saw the 4 ventral cells. | ||
| Strain: BC14222 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00003451 |
