Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr5998

expand all nodes | collapse all nodes | view schema

Name Class

Expr5998Expression_of (2)
HomolHomol_homolCHROMOSOME_I:Expr
Expression_data (2)
TypeReporter_gene[F39B2.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGGCATTCACTGAAAATTAAA] 3' and primer B 5' [CCTGTTTCCTTCACGATTTTG] 3'.
PatternAdult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC11061
ReferenceWBPaper00006525
TransgeneWBTransgene00002467