WormBase Tree Display for Expr_pattern: Expr6059
expand all nodes | collapse all nodes | view schema
Expr6059 | Expression_of (2) | ||||
---|---|---|---|---|---|
Homol | Homol_homol | F43E2:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0005772 | Partial | |||
Remark | anterior cells | ||||
Type | Reporter_gene | [haf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCCATGTTTATATGAGCATT] 3' and primer B 5' [tgatcgatcggtggatctta] 3'. | |||
Pattern | Adult Expression: intestine - anterior cells; | ||||
Larval Expression: intestine - anterior cells; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC10010 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002017 |