Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6115

expand all nodes | collapse all nodes | view schema

Name Class

Expr6115Expression_ofGeneWBGene00003901
Reflects_endogenous_expression_ofWBGene00003901
HomolHomol_homolF48E8:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (20)
TypeReporter_gene[paa-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCGCGGTAATCTTTTT] 3' and primer B 5' [CGACAACCGAGATGATGAAG] 3'.
PatternAdult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Picture (5)
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00002135