Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6134

expand all nodes | collapse all nodes | view schema

Name Class

Expr6134Expression_of (2)
HomolHomol_homolF52B5:Expr
Expression_dataLife_stage (2)
Anatomy_term (16)
TypeReporter_gene[F52B5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGGAAAGAACCGATTGGAA] 3' and primer B 5' [ATTGCATCCAGGAGGTTTTG] 3'.
PatternAdult Expression: Reproductive System; vulval muscle; spermatheca; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; phasmids;
Larval Expression: Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; phasmids;
RemarkAlso expressed in (comments from author) : Pan-neural.
Strain: DM12763
ReferenceWBPaper00006525
TransgeneWBTransgene00001940