Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6147

expand all nodes | collapse all nodes | view schema

Name Class

Expr6147Expression_of (2)
HomolHomol_homolF53B6:Expr
Expression_data (2)
TypeReporter_gene[F53B6.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATAATGTTTTCCGGTCCCTTT] 3' and primer B 5' [TGAACACTTGATTTTCATTCATTT] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
PictureWBPicture0000005439
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14990
ReferenceWBPaper00006525
TransgeneWBTransgene00003820