WormBase Tree Display for Expr_pattern: Expr6192
expand all nodes | collapse all nodes | view schema
Expr6192 | Expression_of | Gene | WBGene00018866 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018866 | ||
Homol | Homol_homol | F55A12:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (9) | |||
Type | Reporter_gene | [F55A12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACGTTTAGTGCAAGTGATAACG] 3' and primer B 5' [GGTCCTGATCTTCAAAGAAAACA] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | ||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |||
Picture | WBPicture0000005559 | ||
WBPicture0000005560 | |||
WBPicture0000005561 | |||
Remark | Also expressed in (comments from author) : Unidentified tail cell is possibly anal sphincter muscle. Cell in head is high-intensity GFP and is below the terminal bulb of the pharynx where it forms two low-intensity arms that go up into head and down to tail. Perhaps misplaced excretory cell? | ||
Strain: BC10680 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004219 |