WormBase Tree Display for Expr_pattern: Expr6192
expand all nodes | collapse all nodes | view schema
Expr6192 | Expression_of | Gene | WBGene00018866 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00018866 | ||||
Homol | Homol_homol | F55A12:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005738 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005767 | |||||
WBbt:0005772 | |||||
WBbt:0005799 | |||||
WBbt:0005812 | |||||
WBbt:0005813 | |||||
Type | Reporter_gene | [F55A12.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACGTTTAGTGCAAGTGATAACG] 3' and primer B 5' [GGTCCTGATCTTCAAAGAAAACA] 3'. | |||
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | ||||
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; rectal gland cells; body wall muscle; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; | |||||
Picture (3) | |||||
Remark | Also expressed in (comments from author) : Unidentified tail cell is possibly anal sphincter muscle. Cell in head is high-intensity GFP and is below the terminal bulb of the pharynx where it forms two low-intensity arms that go up into head and down to tail. Perhaps misplaced excretory cell? | ||||
Strain: BC10680 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00004219 |