Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6193

expand all nodes | collapse all nodes | view schema

Name Class

Expr6193Expression_of (2)
HomolHomol_homolF55A12:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[pqn-44::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAATGTGATCTAAATATACCCGCC] 3' and primer B 5' [CGTCTTCCACGGATTTTCA] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; vulva other; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons;
Larval Expression: pharynx; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body; tail neurons;
RemarkStrain: BC14435
ReferenceWBPaper00006525
TransgeneWBTransgene00003553