Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6238

expand all nodes | collapse all nodes | view schema

Name Class

Expr6238Expression_of (2)
HomolHomol_homolF57B10:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[F57B10.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACCTCATTCTCCATCTTGTCGT] 3' and primer B 5' [GAAGATTGCTGAAAATTTGACTGA] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;
Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;
PictureWBPicture0000005609
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14979
ReferenceWBPaper00006525
TransgeneWBTransgene00003814