Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6257

expand all nodes | collapse all nodes | view schema

Name Class

Expr6257Expression_ofGeneWBGene00010272
Reflects_endogenous_expression_ofWBGene00010272
HomolHomol_homolF58G6:Expr
Expression_data (2)
TypeReporter_gene[F58G6.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGCATTGTTGAGATTGCTT] 3' and primer B 5' [TCTGGAATTTTGGGAAATATGA] 3'.
PatternAdult Expression: intestine; Reproductive System; vulval muscle; spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Remark (2)
ReferenceWBPaper00006525
TransgeneWBTransgene00002107