Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6268

expand all nodes | collapse all nodes | view schema

Name Class

Expr6268Expression_of (2)
HomolHomol_homolF59F4:Expr
Expression_data (2)
TypeReporter_gene[F59F4.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACACTACGTGCTAACAACGGG] 3' and primer B 5' [CTTTGGGGCGATGTTGAG] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; seam cells; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons;
RemarkStrain: BC14547
ReferenceWBPaper00006525
TransgeneWBTransgene00003600