Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6277

expand all nodes | collapse all nodes | view schema

Name Class

Expr6277Expression_of (2)
HomolHomol_homolH19N07:Expr
Expression_data (2)
TypeReporter_gene[H19N07.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATTGGAGCAAGGAATTGA] 3' and primer B 5' [GTTCCAGCCTGAGATTTTGC] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; tail neurons;
RemarkStrain: BC14252
ReferenceWBPaper00006525
TransgeneWBTransgene00003467