WormBase Tree Display for Expr_pattern: Expr6284
expand all nodes | collapse all nodes | view schema
| Expr6284 | Expression_of | Gene | WBGene00005308 |
|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00005308 | ||
| Homol | Homol_homol | H27D07:Expr | |
| Expression_data | Life_stage | WBls:0000041 | |
| WBls:0000023 | |||
| Anatomy_term | WBbt:0005319 | ||
| Type | Reporter_gene | [srh-87::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGAAGAGTTCCGCATAGCAG] 3' and primer B 5' [TGCTCACACGATTTTCACAAA] 3'. | |
| Pattern | Adult Expression: spermatheca; | ||
| Larval Expression: developing spermatheca; | |||
| Picture | WBPicture0000005696 | ||
| Remark | Also expressed in (comments from author) : Note: primers are not unique and produce 3 products. Can predict correct product. | ||
| Strain: BC15966 | |||
| Reference | WBPaper00006525 | ||
| Transgene | WBTransgene00004141 |
