Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6296

expand all nodes | collapse all nodes | view schema

Name Class

Expr6296Expression_ofGeneWBGene00006763
Reflects_endogenous_expression_ofWBGene00006763
HomolHomol_homolY67H2A:Expr
Expression_data (2)
TypeReporter_gene[unc-26::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCTTCTGTTGTTGTGCTCTTC] 3' and primer B 5' [TCCCTCGAACTGAGATTCTCTAA] 3'.
PatternAdult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body;
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells;
RemarkStrain: BC11921
ReferenceWBPaper00006525
TransgeneWBTransgene00002750