Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6297

expand all nodes | collapse all nodes | view schema

Name Class

Expr6297Expression_ofGeneWBGene00006763
Reflects_endogenous_expression_ofWBGene00006763
HomolHomol_homolY67H2A:Expr
Expression_dataLife_stage (2)
Anatomy_term (10)
TypeReporter_gene[unc-26::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCTTCTGTTGTTGTGCTCTTC] 3' and primer B 5' [TCCCTCGAACTGAGATTCTCTAA] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in tail ;
RemarkStrain: BC12678
ReferenceWBPaper00006525
TransgeneWBTransgene00004421