Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6346

expand all nodes | collapse all nodes | view schema

Name Class

Expr6346Expression_of (2)
HomolHomol_homolK07C5:Expr
Expression_dataLife_stage (2)
Anatomy_term (11)
TypeReporter_gene[K07C5.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATAGCGGGTTTTGAGATTGA] 3' and primer B 5' [GGCGTCCTCGATTGTAAACTAC] 3'.
PatternAdult Expression: pharynx; intestine; rectal epithelium; Reproductive System; vulva other; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; rectal epithelium; Reproductive System; developing vulva; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC14607
ReferenceWBPaper00006525
TransgeneWBTransgene00003622