Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6362

expand all nodes | collapse all nodes | view schema

Name Class

Expr6362Expression_of (2)
HomolHomol_homolK08E3:Expr
Expression_data (2)
TypeReporter_gene[cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'.
PatternAdult Expression: pharynx; Reproductive System; vulval muscle; hypodermis;
Larval Expression: pharynx; intestine; hypodermis; Nervous System; ventral nerve cord; tail neurons;
RemarkStrain: BC12415
ReferenceWBPaper00006525
TransgeneWBTransgene00004321