WormBase Tree Display for Expr_pattern: Expr6363
expand all nodes | collapse all nodes | view schema
Expr6363 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | K08E3:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (8) | |||
Type | Reporter_gene | [cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'. | |
Pattern | Adult Expression: intestine; | ||
Larval Expression: pharynx; intestine; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; unidentified cells; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : GFP expression in adults was much less than in the larvae. | ||
Strain: BC10601 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002328 |