Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6363

expand all nodes | collapse all nodes | view schema

Name Class

Expr6363Expression_of (2)
HomolHomol_homolK08E3:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (8)
TypeReporter_gene[cyk-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCGATAAATTGGACGGTATATT] 3' and primer B 5' [CTGGACTTGATTCTAAAATGTGGA] 3'.
PatternAdult Expression: intestine;
Larval Expression: pharynx; intestine; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; unidentified cells; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : GFP expression in adults was much less than in the larvae.
Strain: BC10601
ReferenceWBPaper00006525
TransgeneWBTransgene00002328