WormBase Tree Display for Expr_pattern: Expr6366
expand all nodes | collapse all nodes | view schema
Expr6366 | Expression_of (2) | ||
---|---|---|---|
Homol | Homol_homol | K08E7:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
Anatomy_term (7) | |||
Type | Reporter_gene | [hsb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCTTTTGTCGAATGAAACGAAT] 3' and primer B 5' [ACTTCTCATCGGAGATTTTGAAC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; tail neurons; | ||
Remark | Also expressed in (comments from author) : incomplete. Will be updated. | ||
Strain: BC11914 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002749 |