WormBase Tree Display for Expr_pattern: Expr6430
expand all nodes | collapse all nodes | view schema
Expr6430 | Expression_of | Gene | WBGene00010941 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00010941 | ||
Homol | Homol_homol | M176:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [M176.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGAAGGAACAAGTGTTTGTTTG] 3' and primer B 5' [GAGCGATTCTTGAAAAATTACGA] 3'. | |
Pattern | Adult Expression: pharynx; intestine; unidentified cells in head; | ||
Larval Expression: pharynx; intestine; unidentified cells in head; | |||
Remark | Also expressed in (comments from author) : An unidentified bright cell in the head.Embryo incomplete. To be updated. | ||
Strain: BC11834 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002710 |