WormBase Tree Display for Expr_pattern: Expr6430
expand all nodes | collapse all nodes | view schema
Expr6430 | Expression_of | Gene | WBGene00010941 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00010941 | ||||
Homol | Homol_homol | M176:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [M176.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGAAGGAACAAGTGTTTGTTTG] 3' and primer B 5' [GAGCGATTCTTGAAAAATTACGA] 3'. | |||
Pattern (2) | |||||
Remark | Also expressed in (comments from author) : An unidentified bright cell in the head.Embryo incomplete. To be updated. | ||||
Strain: BC11834 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002710 |