Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6483

expand all nodes | collapse all nodes | view schema

Name Class

Expr6483Expression_ofGeneWBGene00011146
Reflects_endogenous_expression_ofWBGene00011146
HomolHomol_homolR08D7:Expr
Expression_dataLife_stage (2)
Anatomy_term (16)
TypeReporter_gene[pde-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCGCAGACAAACTTTAACCAA] 3' and primer B 5' [GTGCCGCACTTCGATTTT] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Picture (5)
RemarkStrain: BC14176
ReferenceWBPaper00006525
TransgeneWBTransgene00003433