Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6489

expand all nodes | collapse all nodes | view schema

Name Class

Expr6489Expression_of (2)
HomolHomol_homolR09E12:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (18)
TypeReporter_gene[srbc-58::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGGCCCAACTATTGGAAACT] 3' and primer B 5' [AGCTTCCAGTCGAATGAACAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing gonad; developing vulva; developing spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (4)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16165
ReferenceWBPaper00006525
TransgeneWBTransgene00004187