Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6497

expand all nodes | collapse all nodes | view schema

Name Class

Expr6497Expression_of (2)
HomolHomol_homolR10H1:Expr
Expression_data (2)
TypeReporter_gene[srab-14::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGCGACCTCAGTTTTTGAG] 3' and primer B 5' [TGTTTTGTCTGAAAATTCGGG] 3'.
PatternAdult Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;
Larval Expression: excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; mechanosensory neurons; pharyngeal neurons; neurons along body; tail neurons; phasmids;
PictureWBPicture0000006026
WBPicture0000006027
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14834
ReferenceWBPaper00006525
TransgeneWBTransgene00003734