WormBase Tree Display for Expr_pattern: Expr6622
expand all nodes | collapse all nodes | view schema
Expr6622 | Expression_of | Gene | WBGene00011543 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011543 | ||
Homol | Homol_homol | T06E8:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (4) | |||
Type | Reporter_gene | [T06E8.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAACTGCTCGGATAGGTGAA] 3' and primer B 5' [CGACCAGAAGTTCTCGATTTTC] 3'. | |
Pattern | Adult Expression: pharynx; intestine; body wall muscle; unidentified cells in body ; | ||
Larval Expression: intestine; body wall muscle; unidentified cells in body ; | |||
Remark | Also expressed in (comments from author) : uEmbryo incomplete. To be updated. | ||
Strain: BC10342 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00002201 |