Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6703

expand all nodes | collapse all nodes | view schema

Name Class

Expr6703Expression_ofGeneWBGene00020549
Reflects_endogenous_expression_ofWBGene00020549
HomolHomol_homolT17E9:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[T17E9.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCGTTGCTGTAAAATCTCAAT] 3' and primer B 5' [GTGTCCGTGGGAGATAACTAGG] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Picture (3)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16236
ReferenceWBPaper00006525
TransgeneWBTransgene00004198