WormBase Tree Display for Expr_pattern: Expr6711
expand all nodes | collapse all nodes | view schema
Expr6711 | Expression_of | Gene | WBGene00011832 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00011832 | ||
Homol | Homol_homol | T19B10:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0004697 | ||
Type | Reporter_gene | [T19B10.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATGGAGCCCCACCTTC] 3' and primer B 5' [TGTAAACAAATGAATCTTATTGGG] 3'. | |
Pattern | Adult Expression: head mesodermal cell; | ||
Larval Expression: head mesodermal cell; | |||
Picture | WBPicture0000006412 | ||
Remark | Also expressed in (comments from author) : a beautiful, clean example of the HMC | ||
Strain: BC13743 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003271 |