Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6715

expand all nodes | collapse all nodes | view schema

Name Class

Expr6715Expression_of (2)
HomolHomol_homolT19D7:Expr
Expression_data (2)
TypeReporter_gene[T19D7.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTGCTTGAATGATAGAAAATGGG] 3' and primer B 5' [CAACTCGTTCATGATTTTGGC] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; Reproductive System; uterine-seam cell; spermatheca; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons;
Larval Expression: pharynx; intestine; rectal gland cells; Reproductive System; developing gonad; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons;
PictureWBPicture0000006416
WBPicture0000006417
WBPicture0000006418
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC14981
ReferenceWBPaper00006525
TransgeneWBTransgene00003815