Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6739

expand all nodes | collapse all nodes | view schema

Name Class

Expr6739Expression_of (2)
HomolHomol_homolK08F11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (13)
TypeReporter_gene[T22B11.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAATGTTCCCCACTCTTCTGA] 3' and primer B 5' [ACTCGCCCGATGGATGGT] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; seam cells; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; seam cells; Nervous System; ventral nerve cord; unidentified cells in head; unidentified cells in tail ;
Picture (3)
RemarkStrain: BC10495
ReferenceWBPaper00006525
TransgeneWBTransgene00002283