Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6751

expand all nodes | collapse all nodes | view schema

Name Class

Expr6751Expression_ofGeneWBGene00004391
Reflects_endogenous_expression_ofWBGene00004391
HomolHomol_homolT23G5:Expr
Expression_dataLife_stage (2)
Anatomy_term (12)
TypeReporter_gene[rnr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGAAAATTCGCAATCACAG] 3' and primer B 5' [TTGTAACGTTGGATAACTGGAAAA] 3'.
PatternAdult Expression: hypodermis; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ;
Larval Expression: intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ;
Picture (3)
RemarkStrain: BC12610
ReferenceWBPaper00006525
TransgeneWBTransgene00002558