Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6768

expand all nodes | collapse all nodes | view schema

Name Class

Expr6768Expression_ofGeneWBGene00004270
Reflects_endogenous_expression_ofWBGene00004270
HomolHomol_homolT25G12:Expr
Expression_dataLife_stage (2)
Anatomy_term (10)
TypeReporter_gene[rab-6.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCTGCAATGCCTGAAGTA] 3' and primer B 5' [TACCAAAGTCCGAGATTTTTCTG] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons; unidentified cells;
Larval Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells;
RemarkStrain: BC11323
ReferenceWBPaper00006525
TransgeneWBTransgene00002560