Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6817

expand all nodes | collapse all nodes | view schema

Name Class

Expr6817Expression_ofGeneWBGene00012205
Reflects_endogenous_expression_ofWBGene00012205
HomolHomol_homolW02B12:Expr
Expression_data (2)
TypeReporter_gene[W02B12.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTCTCGGATGAAGCATTGG] 3' and primer B 5' [AGTTATGTCGATGTTTTTGCTGAA] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulva other; spermatheca; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons;
Larval Expression: pharynx; intestine; Reproductive System; developing uterus; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons;
Picture (4)
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC14283
ReferenceWBPaper00006525
TransgeneWBTransgene00003484