Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6831

expand all nodes | collapse all nodes | view schema

Name Class

Expr6831Expression_ofGeneWBGene00021004
Reflects_endogenous_expression_ofWBGene00021004
HomolHomol_homolW03F9:Expr
Expression_data (2)
TypeReporter_gene[W03F9.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCCACCTGATTTGACTTCATTC] 3' and primer B 5' [CGCCTGAGATCTGAAAAAGG] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; spermatheca; body wall muscle; Nervous System; head neurons; tail neurons;
Larval Expression: pharynx; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; developing spermatheca; body wall muscle; Nervous System; head neurons; tail neurons;
Picture (5)
RemarkStrain: BC11329
ReferenceWBPaper00006525
TransgeneWBTransgene00002563