Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6885

expand all nodes | collapse all nodes | view schema

Name Class

Expr6885Expression_ofGeneWBGene00004700
Reflects_endogenous_expression_ofWBGene00004700
HomolHomol_homolY111B2A:Expr
Expression_data (2)
TypeReporter_gene[rsp-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAACCGAAAACCACAAAAA] 3' and primer B 5' [CCACATCCGGATAGCAGAC] 3'.
PatternAdult Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
Picture (3)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC13726
ReferenceWBPaper00006525
TransgeneWBTransgene00003266