Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6893

expand all nodes | collapse all nodes | view schema

Name Class

Expr6893Expression_of (2)
HomolHomol_homolY116A8C:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (12)
TypeReporter_gene[snr-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAAAAATGGTGTTCTAAAGCAAA] 3' and primer B 5' [ACACCAACTGAAGTGATTCTGAAA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; seam cells; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; anal depressor muscle; body wall muscle; hypodermis; seam cells; coelomocytes; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC11210
ReferenceWBPaper00006525
TransgeneWBTransgene00002357