Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6908

expand all nodes | collapse all nodes | view schema

Name Class

Expr6908Expression_of (2)
HomolHomol_homolY22F5A:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (4)
TypeReporter_gene[Y22F5A.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTTGACCAAAACGTAACTTTTCA] 3' and primer B 5' [ATTATTGCTTGTTGTCTGACCGT] 3'.
PatternAdult Expression: Nervous System; ventral nerve cord; head neurons; unidentified cells in head;
Larval Expression: Nervous System; ventral nerve cord; head neurons; unidentified cells in head;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC13241
ReferenceWBPaper00006525
TransgeneWBTransgene00003110