WormBase Tree Display for Expr_pattern: Expr6914
expand all nodes | collapse all nodes | view schema
Expr6914 | Expression_of | Gene | WBGene00021292 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00021292 | ||
Homol | Homol_homol | Y25C1A:Expr | |
Expression_data (2) | |||
Type | Reporter_gene | [Y25C1A.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGGGTTTTTATTGCGTTTTT] 3' and primer B 5' [AGCTGATTGTGGAGGAGCTG] 3'. | |
Pattern | Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; excretory cell; | ||
Larval Expression: pharynx; pharyngeal gland cells; intestine - anterior cells; body wall muscle; excretory cell; unidentified cells; | |||
Picture | WBPicture0000006766 | ||
Remark | Also expressed in (comments from author) : Adult GFP is lower intensity than larval and embryo. | ||
Strain: BC10453 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004221 |