Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6955

expand all nodes | collapse all nodes | view schema

Name Class

Expr6955Expression_ofGeneWBGene00000022
Reflects_endogenous_expression_ofWBGene00000022
HomolHomol_homolT22H9:Expr
Expression_data (2)
TypeReporter_gene[abt-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTGCTTTGGAATTTCAGGT] 3' and primer B 5' [CAA TGC ACC GAT TCT GAA AA] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; rectal gland cells; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : This strain is not available.
Strain: BC11522
ReferenceWBPaper00006525
TransgeneWBTransgene00004268