WormBase Tree Display for Expr_pattern: Expr7004
expand all nodes | collapse all nodes | view schema
Expr7004 | Expression_of | Gene | WBGene00012985 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012985 | ||||
Homol | Homol_homol | Y48C3A:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0003681 | |||||
WBbt:0003822 | |||||
WBbt:0003833 | |||||
WBbt:0005300 | |||||
WBbt:0005733 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005747 | |||||
WBbt:0005753 | |||||
WBbt:0005767 | |||||
WBbt:0005799 | |||||
WBbt:0005813 | |||||
WBbt:0005821 | |||||
WBbt:0006749 | |||||
WBbt:0006751 | |||||
WBbt:0006760 | |||||
Type | Reporter_gene | [Y48C3A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAAAGGAGGAAGAAGCGG] 3' and primer B 5' [GCCTTTGATAATTGGATTCTGA] 3'. | |||
Pattern | Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | ||||
Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; Reproductive System; developing uterus; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in head; unidentified cells in tail ; | |||||
Picture | WBPicture0000006850 | ||||
Remark | Also expressed in (comments from author) : unidentified cells in head and tail, possibly neural | ||||
Strain: BC13333 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003141 |