Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7029

expand all nodes | collapse all nodes | view schema

Name Class

Expr7029Expression_of (2)
HomolHomol_homolY51H7C:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[Y51H7C.11::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACTGGTTGGGACTGTTAAAT] 3' and primer B 5' [CTGTCTCGATCTCTGCAAATAGAA] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; Reproductive System; developing vulva; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC15216
ReferenceWBPaper00006525
TransgeneWBTransgene00003887