Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7059

expand all nodes | collapse all nodes | view schema

Name Class

Expr7059Expression_of (2)
HomolHomol_homolY55D9A:Expr
Expression_data (2)
TypeReporter_gene[Y55D9A.2a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCCCCTTCCCCCTATCTT] 3' and primer B 5' [GCGTAGATTTACCATTTTTCCAGT] 3'.
PatternLarval Expression: intestine;
RemarkStrain: BC11245
ReferenceWBPaper00006525
TransgeneWBTransgene00002530